Then PCR was performed for 30 cycles at 95°C, 30 s; 55°C, 30 s; 72°C, 30 s with a final amplification for 5 min at 72°C. The IL-8 gene was amplified using the primers IL-8 Forward GTTCCACTGTGCCTTGGTTT and IL-8 Reverse ACACAGCTGGCAATGACAAG, and the β-actin

gene as control was amplified using β-actin Forward AAATCTGGCACCACACCTTC and www.selleckchem.com/products/mk-4827-niraparib-tosylate.html β-actin Reverse AGTGGGGTGGCTTTTAGGAT. Visualisation of the PCR products was performed following agarose gel electrophoresis using SYBRsafe (Invitrogen) and a UV light source on a G:Box from SynGene and using the software GeneSnap from Syngene. Quantification was performed by comparing the intensity of the PCR product bands to the Quantitative Hyperladder I (Bioline) as a reference and then determining the ratio between IL-8 and β-actin PCR products in each sample. Statistical analysis Significance of the differences between groups was assessed using one way analysis of variance (ANOVA) with post-hoc Tukey-Kramer multiple comparisons test using GraphPad Instat software. p < 0.05 were considered statistically significant. Acknowledgements We thank Prof Takeshi Honda (Osaka University, Japan) for providing V. parahaemolyticus RIMD2210633, Dr Dominique Schneider CB-5083 cell line for providing plasmid

pDS132 (Université Joseph Fourier, France) and Dr Eric Stabb (University of Georgia at Athens, USA) for providing E. coli CC118λpir(pEVS104). We thank Ann Smyth and Niamh McCormack Thalidomide for assistance in construction of mutants and Stephen Cunningham for assistance with the MDC assay. KMW and AM were funded by Marie Curie Transfer of Knowledge “”GAMIDI”" EU Transfer of Knowledge grant # MTKD-CT-2005-029774 and RF was funded by Science Foundation Ireland Research Frontiers Programme grant # 08-RFP-BIC1243. Some of the early studies for this work were funded by the National University of Ireland, Galway’s Millennium Fund. Electronic supplementary material Additional file 1: Figure S1: Morphological changes induced in Caco-2 cells by V. parahaemolyticus Δ vp1680. Caco-2 cells were co-incubated

with V. parahaemolyticus WT, ΔvscN1, ΔvscN2 or Δvp1680 for 4 h. Morphological changes of the cells were then observed by phase contrast light microscope (magnification 400×). (PDF 948 KB) References 1. Krantz GE, Colwell RR, Lovelace E: SB525334 manufacturer Vibrio parahaemolyticus from the blue crab Callinectes sapidus in Chesapeake Bay. Science 1969,164(885):1286–1287.PubMedCrossRef 2. Kaneko T, Colwell RR: Ecology of Vibrio parahaemolyticus in Chesapeake Bay. J Bacteriol 1973,113(1):24–32.PubMed 3. Nair GB, Ramamurthy T, Bhattacharya SK, Dutta B, Takeda Y, Sack DA: Global dissemination of Vibrio parahaemolyticus serotype O3:K6 and its serovariants. Clin Microbiol Rev 2007,20(1):39–48.PubMedCrossRef 4. Boyd EF, Cohen AL, Naughton LM, Ussery DW, Binnewies TT, Stine OC, Parent MA: Molecular analysis of the emergence of pandemic Vibrio parahaemolyticus .