PCR reaction A 2941 pb segment of the eae gene, a 1559 pb segment

PCR reaction A 2941 pb segment of the eae gene, a 1559 pb segment of the tir gene and a 753 pb segment of tccP2 gene were amplified by PCR, using respectively four pairs of primers, two pairs of primers and one pair of primers. All the primers KU-57788 clinical trial used in this study and all the AZD9291 Annealing temperatures are listed in

Table 4. For PCR reactions, the following mixture was used: 1 U of Taq DNA polymerase (New England Biolabs, USA), 5 μl of 2 mM deoxynucleoside triphosphates, 5 μl of 10X ThermoPol Reaction Buffer (20 mM Tris-HCl (pH 8.8, 25°C), 10 mM KCl, 10 mM (NH4)2SO4, 2 mM MgSO4, 0.1% Triton X-100), 5 μl of each primer (10 μM), and 3 μl of a DNA template in a total volume of 50 μl. Table 4 Primers used in this study (R = A+G, K = T+G, Y = C+T) Primer name Sequence (5′ to 3′) Target gene Annealing temp. (°C) Amplicon size (bp) Reference B52 AGGCTTCGTCACAGTTG eaeA 50 570 [39] B53 CCATCGTCACCAGAGGA         B54 AGAGCGATGTTACGGTTTG stx1 50 388 [39] B55 TTGCCCCCAGAGTGGATG         B56 TGGGTTTTTCTTCGGTATC stx2 50 807 [39] MLN2238 order B57 GACATTCTGGTTGACTCTCTT         wzx-wzyO26-F AAATTAGAAGCGCGTTCATC wzx O26

56 596 [41] wzx-wzyO26-R CCCAGCAAGCCAATTATGACT         fliC-H11-F ACTGTTAACGTAGATAGC fliC H11 56 224 [41] fliC-H11-R TCAATTTCTGCAGAATATAC         B139 CRCCKCCAYTACCTTCACA tir β 53 560 [27] B140 GATTTTTCCCTCGCCACTA         tir(591-1617)-F TCCAAATAGTGGCGAGGGAA tir β 54 1026 This study tir(591-1617)-R TTAAACGAAACGTGCGGGTC         B73 TACTGAGATTAAGGCTGATAA eae β 50 520 [27] B137 TGTATGTCGCACTCTGATT         eae(37-1142)-F CGGCACAAGCATAAGCTAAA eae β 51 1105 This study eae(37-1142)-R AGTTTACACCAACGGTCGCC         eae(1001-2046)-F TCCGCTTTAATGGCTATTTACC eae β 50 1045 This study eae(1001-2046)-R TGCCTTCGCTGTTGTTTTAT         eae(2319-2972)-F GGCTCTGCAAAGAACTGGTT eae β 50 653 This study eae(2319-2972)-R AGTCTCTATCAAACAAGGATACACG         tccP2-F ATGATAAATAGCATTAATTCTTT tccP2 56 753 [24] tccP2-R TCACGAGCGCTTAGATGTATTAAT

        DNA sequencing The DNA fragments amplified were purified using the NucleoSpin Extract II kit (Macherey-Nagel, Germany) according to the manufacturer’s instructions. Sequencing of the two DNA strands was performed by the dideoxynucleotide PLEK2 triphosphate chain termination method with a 3730 ABI capillary sequencer and a BigDye Terminator kit version 3.1 (Applied Biosystems, USA) at the GIGA (Groupe Interdisciplinaire de Génoprotéomique Appliquée, Belgium). Sequence analysis was performed using Vector NTI 10.1.1 (Invitrogen, USA). DNA sequencing was performed three times. Statistical analysis A Fisher’s exact test was performed to assess statistical differences. Acknowledgements Marjorie Bardiau is a PhD fellow of the “”Fonds pour la formation à la Recherche dans l’Industrie et dans l’Agriculture”" (FRIA).

Comments are closed.